CBSE Class 12 Biology Worksheet Set B Solved

Read and download free pdf of CBSE Class 12 Biology Worksheet Set B Solved. Download printable Biology Class 12 Worksheets in pdf format, CBSE Class 12 Biology All Chapters Worksheet has been prepared as per the latest syllabus and exam pattern issued by CBSE, NCERT and KVS. Also download free pdf Biology Class 12 Assignments and practice them daily to get better marks in tests and exams for Class 12. Free chapter wise worksheets with answers have been designed by Class 12 teachers as per latest examination pattern

All Chapters Biology Worksheet for Class 12

Class 12 Biology students should refer to the following printable worksheet in Pdf in Class 12. This test paper with questions and solutions for Class 12 Biology will be very useful for tests and exams and help you to score better marks

Class 12 Biology All Chapters Worksheet Pdf

1. Lactose is considered an inducer in lac operon. Give reason.
 
2. What do you mean by biogenesis? 
 
3. If the sequence of the coding strand in a transcription unit is written as follows:
5- ATCGATCGATCGATCGATCGATCGATCG – 3 Write the sequence of mRNA transcribed from it.
 
4. Expand Eco R1. 
 
5. Describe the isolation of DNA from bacterial cell.
 
6. Explain any two methods of vector less gene transfer. 
 
7. Why hn RNA needs to undergo splicing? 
 
8. Differentiate between the theories of Charles Darwin and Hugo de Vries regarding evolution.
 
OR
 
What is founder effect? List any two factors affecting Hardy Weinberg equilibrium.
 
9. Describe two salient features of genetic code. 
 
10. Explain Nucleosome model of chromosome with a neat labeled diagram.
 
OR
 
List any 3 salient features of Double Helix model of DNA.
 
11. Discuss different steps involved in the process of amplification of DNA.
 
OR
 
Explain how β galactosidase site acts as selectable marker.
 

Please click on below link to download CBSE Class 12 Biology Worksheet Set B Solved

All Chapters CBSE Class 12 Biology Worksheet

The above practice worksheet for All Chapters has been designed as per the current syllabus for Class 12 Biology released by CBSE. Students studying in Class 12 can easily download in Pdf format and practice the questions and answers given in the above practice worksheet for Class 12 Biology on a daily basis. All the latest practice worksheets with solutions have been developed for Biology by referring to the most important and regularly asked topics that the students should learn and practice to get better scores in their examinations. Studiestoday is the best portal for Printable Worksheets for Class 12 Biology students to get all the latest study material free of cost. Teachers of studiestoday have referred to the NCERT book for Class 12 Biology to develop the Biology Class 12 worksheet. After solving the questions given in the practice sheet which have been developed as per the latest course books also refer to the NCERT solutions for Class 12 Biology designed by our teachers. After solving these you should also refer to Class 12 Biology MCQ Test for the same chapter. We have also provided a lot of other Worksheets for Class 12 Biology which you can use to further make yourself better in Biology.

Where can I download latest CBSE Practice worksheets for Class 12 Biology All Chapters

You can download the CBSE Practice worksheets for Class 12 Biology All Chapters for the latest session from StudiesToday.com

Are the Class 12 Biology All Chapters Practice worksheets available for the latest session

Yes, the Practice worksheets issued for All Chapters Class 12 Biology have been made available here for the latest academic session

Is there any charge for the Practice worksheets for Class 12 Biology All Chapters

There is no charge for the Practice worksheets for Class 12 CBSE Biology All Chapters you can download everything free

How can I improve my scores by solving questions given in Practice worksheets in All Chapters Class 12 Biology

Regular revision of practice worksheets given on studiestoday for Class 12 subject Biology All Chapters can help you to score better marks in exams

Are there any websites that offer free Practice test papers for Class 12 Biology All Chapters

Yes, studiestoday.com provides all the latest Class 12 Biology All Chapters test practice sheets with answers based on the latest books for the current academic session