CBSE Class 12 Biology Worksheet Set 02 Solved

Access the latest CBSE Class 12 Biology Worksheet Set 02 Solved. We have provided free printable Class 12 Biology worksheets in PDF format, specifically designed for All Chapters. These practice sets are prepared by expert teachers following the 2025-26 syllabus and exam patterns issued by CBSE, NCERT, and KVS.

All Chapters Biology Practice Worksheet for Class 12

Students should use these Class 12 Biology chapter-wise worksheets for daily practice to improve their conceptual understanding. This detailed test papers include important questions and solutions for All Chapters, to help you prepare for school tests and final examination. Regular practice of these Class 12 Biology questions will help improve your problem-solving speed and exam accuracy for the 2026 session.

Download Class 12 Biology All Chapters Worksheet PDF

1. Lactose is considered an inducer in lac operon. Give reason.
 
2. What do you mean by biogenesis? 
 
3. If the sequence of the coding strand in a transcription unit is written as follows:
5- ATCGATCGATCGATCGATCGATCGATCG – 3 Write the sequence of mRNA transcribed from it.
 
4. Expand Eco R1. 
 
5. Describe the isolation of DNA from bacterial cell.
 
6. Explain any two methods of vector less gene transfer. 
 
7. Why hn RNA needs to undergo splicing? 
 
8. Differentiate between the theories of Charles Darwin and Hugo de Vries regarding evolution.
 
OR
 
What is founder effect? List any two factors affecting Hardy Weinberg equilibrium.
 
9. Describe two salient features of genetic code. 
 
10. Explain Nucleosome model of chromosome with a neat labeled diagram.
 
OR
 
List any 3 salient features of Double Helix model of DNA.
 
11. Discuss different steps involved in the process of amplification of DNA.
 
OR
 
Explain how β galactosidase site acts as selectable marker.
 

Please click on below link to download CBSE Class 12 Biology Worksheet Set B Solved

All Chapters CBSE Class 12 Biology Worksheet

Students can use the All Chapters practice sheet provided above to prepare for their upcoming school tests. This solved questions and answers follow the latest CBSE syllabus for Class 12 Biology. You can easily download the PDF format and solve these questions every day to improve your marks. Our expert teachers have made these from the most important topics that are always asked in your exams to help you get more marks in exams.

NCERT Based Questions and Solutions for All Chapters

Our expert team has used the official NCERT book for Class 12 Biology to create this practice material for students. After solving the questions our teachers have also suggested to study the NCERT solutions  which will help you to understand the best way to solve problems in Biology. You can get all this study material for free on studiestoday.com.

Extra Practice for Biology

To get the best results in Class 12, students should try the Biology MCQ Test for this chapter. We have also provided printable assignments for Class 12 Biology on our website. Regular practice will help you feel more confident and get higher marks in CBSE examinations.

Where can I download the latest PDF for CBSE Class 12 Biology Worksheet Set 02 Solved?

You can download the teacher-verified PDF for CBSE Class 12 Biology Worksheet Set 02 Solved from StudiesToday.com. These practice sheets for Class 12 Biology are designed as per the latest CBSE academic session.

Are these Biology Class 12 worksheets based on the 2026-27 competency-based pattern?

Yes, our CBSE Class 12 Biology Worksheet Set 02 Solved includes a variety of questions like Case-based studies, Assertion-Reasoning, and MCQs as per the 50% competency-based weightage in the latest curriculum for Class 12.

Do you provide solved answers for CBSE Class 12 Biology Worksheet Set 02 Solved?

Yes, we have provided detailed solutions for CBSE Class 12 Biology Worksheet Set 02 Solved to help Class 12 and follow the official CBSE marking scheme.

How does solving CBSE Class 12 Biology Worksheet Set 02 Solved help in exam preparation?

Daily practice with these Biology worksheets helps in identifying understanding gaps. It also improves question solving speed and ensures that Class 12 students get more marks in CBSE exams.

Is there any charge for the Class 12 Biology practice test papers?

All our Class 12 Biology practice test papers and worksheets are available for free download in mobile-friendly PDF format. You can access CBSE Class 12 Biology Worksheet Set 02 Solved without any registration.